View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9360_low_51 (Length: 211)
Name: NF9360_low_51
Description: NF9360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9360_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 95 - 198
Target Start/End: Complemental strand, 6917921 - 6917818
Alignment:
| Q |
95 |
caaattaccattacttcaagtttttaacctttaccattgatcttggaaacgaccatgtaaccttgttgttctcatgacataagccatttgacttttcaac |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917921 |
caaattaccattacttcaagtttttaacctttaccgttgatcttggaaatgaccatgtaaccttgttgttctcatgacataagccatttgacttttcaac |
6917822 |
T |
 |
| Q |
195 |
acca |
198 |
Q |
| |
|
|||| |
|
|
| T |
6917821 |
acca |
6917818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University