View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9360_low_55 (Length: 207)
Name: NF9360_low_55
Description: NF9360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9360_low_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 13 - 192
Target Start/End: Complemental strand, 12876141 - 12875962
Alignment:
| Q |
13 |
agcagagaagccggttcgttcaaggccttcataagcagtctcaattgtcaaaggaagactagcagcctcagcaaagctcagattttttggcttgtgagcc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12876141 |
agcagagaagccggttcgttcaaggccttcataagcagtctcaattgtcaaaggaagactagcagcctcagcaaagctcagatttttcggcttgtgagcc |
12876042 |
T |
|
| Q |
113 |
aacagtatctcttctgcagcagtgtactccgccagtgaaccaatgacctttggatattccaaagctttcacattgatatc |
192 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12876041 |
aacagtatctcttctgcagcagtgtactctgccagtgaaccaatgacctttggatattccaaagctttcacattgatatc |
12875962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University