View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_high_25 (Length: 334)
Name: NF9361A_high_25
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 7e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 39 - 179
Target Start/End: Original strand, 16689695 - 16689835
Alignment:
| Q |
39 |
ttctgtaataaatgtacaaaatgtacctgatccttgttaaatagtgcaggccaatccttcatttccacaagccttttagcaacatcgcgactcaaagaaa |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16689695 |
ttctgtaataaatgtacaaaatgtacctgatccttgttaaatagtgcaggccaatccttcatttccacaagccttttagcaacatcgcgactcaaagaaa |
16689794 |
T |
 |
| Q |
139 |
ttctgtaattcaagtccccgaaccatataattcggctggag |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16689795 |
ttctgtaattcaagtccccgaaccatataattcggctggag |
16689835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 261 - 334
Target Start/End: Original strand, 16689928 - 16690001
Alignment:
| Q |
261 |
gtctctgcattataactttaaaactagttttgaatgatacttactcgtgatctaaaattttgtcaggcatccta |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16689928 |
gtctctgcattataactttaaaactagttttgaatgatacttactcgtgatctaaaattttgtcaggcatccta |
16690001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University