View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_high_30 (Length: 306)
Name: NF9361A_high_30
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 302
Target Start/End: Complemental strand, 6315410 - 6315108
Alignment:
| Q |
1 |
actatttgctcactccatatccctccatacagacatcacttcatcttcatttgtcaagggatcc-atctgcccaacaagtctccgttgctactaatccac |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||| || | ||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315410 |
actatttgctcactccataaccctccataaagccgtcacttcatcttcatttgtaaagggatcccatctgcccaacaagtctccgttgctactaatccac |
6315311 |
T |
 |
| Q |
100 |
ctgttgccatatgacaagtacccctgttgtggttttttccatctactatatgcctcgtgttaatctccaaattctaagtattttgctgctttttcttttg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315310 |
ctgttgccatatgacaagtacccctgttgtggtcttttccatctactatatgcctcgtgttaatctccaaattctaagtattttgctgctttttcttttg |
6315211 |
T |
 |
| Q |
200 |
ccatttcaaaacaacagggaactaaatagcttgttggattgttgccaggcatattccaaagctgcttacttcttctcttccatatattccacaacaccat |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6315210 |
ccatttcaaaacaacagggaactaaatagcttgttggattgttgccaggcatattccaaagctgcttacttcttctcttccatatattccacaacaccat |
6315111 |
T |
 |
| Q |
300 |
agt |
302 |
Q |
| |
|
||| |
|
|
| T |
6315110 |
agt |
6315108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University