View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_high_36 (Length: 262)
Name: NF9361A_high_36
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_high_36 |
 |  |
|
| [»] scaffold0246 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 7 - 239
Target Start/End: Complemental strand, 51254534 - 51254302
Alignment:
| Q |
7 |
tcgaagaatatagggcaaaaagtgccttgttgttgtttgagaacgcagtttgtgcagaaacgacggttgatggctctgtaggtgatagtgtggaggaaga |
106 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51254534 |
tcgaagcaaatagggcaaaaagtgccttgttgttgtttgagaacgcagtttgtgcagaaacgacggttgatggctctgtaggtgatagtgtggaggaaga |
51254435 |
T |
 |
| Q |
107 |
gagaggttgtcggtgtgaagccgcaacagttgcatggctccggtgaggattggaagggattcatcggaatggcattggatagggcttcgtacgtggattg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51254434 |
gagaggttgtcggtgtgaagccgcaacagtcgcatggctccggtgaggattggaagggattcatcggaatggcattggatagggcttcgtacgtggattg |
51254335 |
T |
 |
| Q |
207 |
tcttaacggtaaccctagaaatgtagtgagagt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
51254334 |
tcttaacggtaaccctagaaatgtagtgagagt |
51254302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0246 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 16 - 114
Target Start/End: Complemental strand, 11863 - 11764
Alignment:
| Q |
16 |
atagggcaaaaagtgccttgttgttgtttgagaacgcagtttgtgcagaaacg-acggttgatggctctgtaggtgatagtgtggaggaagagagaggtt |
114 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||| |||||||||||||| || ||||||||||||| |||||| | |||||||| |||||||||| |
|
|
| T |
11863 |
atagggaaagaagtgccttgttgttgtttgagaacgcaatttgtgcagaaacgaacatttgatggctctgttggtgatggcgtggaggatgagagaggtt |
11764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University