View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_high_38 (Length: 257)
Name: NF9361A_high_38
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_high_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 23 - 249
Target Start/End: Complemental strand, 46869531 - 46869305
Alignment:
| Q |
23 |
ataatttactatacttattgcattaaaatgccttcatgatgctttatgataagctttcatcgtatttttcgggaggatgtaaataacttaccatactttc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46869531 |
ataatttactatacttattgcattaaaatgccttcatgatgctttatgataagctttcatcgtatttttcgggaggatgtaaataacttaccatactttc |
46869432 |
T |
 |
| Q |
123 |
ttgcattaaatttaaaatttaacaactgtatcatagaaaagggaataatatcatatctacatgcatgagaaaacccagcccccgatatatcacagatgca |
222 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
46869431 |
tagcattaaatttaaaatttaacaactgtatcatagaaaagggaataatatcatatctacatgcatgagaaaaccaagcccccgatatatcacagatgta |
46869332 |
T |
 |
| Q |
223 |
aatgacaaataatatcatatctttgtt |
249 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
46869331 |
aatgacaaataatatcatatctttgtt |
46869305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University