View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_high_41 (Length: 247)
Name: NF9361A_high_41
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_high_41 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 24 - 247
Target Start/End: Complemental strand, 7875352 - 7875129
Alignment:
| Q |
24 |
cttgtgaggctgagaattttcatcactcttggtcatcatcaaattcaaggcatgattggtcttaactcgcgacacatcggaactaaaactattgtccaat |
123 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7875352 |
cttgtgaggatgagaattttcattactcttggtcatcatcaaattcaaggcatgattggtcttaactcgcgacacatcggaactaaaactattgtccaat |
7875253 |
T |
 |
| Q |
124 |
gatccaagagacatgttagtaagatccattggcaagttcagatcattgaaataacttcccaaactcttaatggaggtgattgaagcatccaacaacataa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7875252 |
gatccaagagacatgttagtaagatccattggcaagtttagatcattgaaataacttcccaaactcttaatggaggtgattgaagcatccaacaacataa |
7875153 |
T |
 |
| Q |
224 |
aatcttctgtatgtctacttggat |
247 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7875152 |
aatcttctgtatgtctacttggat |
7875129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University