View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_high_48 (Length: 214)
Name: NF9361A_high_48
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_high_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 22 - 200
Target Start/End: Complemental strand, 16353456 - 16353278
Alignment:
| Q |
22 |
caaacttcaaagaaattctttcaaatcggattcattacttctattgaatgacttctctctgatagtatccaatagaggtctccataaccgccctctacac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16353456 |
caaacttcaaagaaattctttcaaatcggattcattacttctattgaatgacttctctctgatagtatccaatagaggtctccataaccgccctctacac |
16353357 |
T |
 |
| Q |
122 |
gtgcttcgtcctccatacgtcataccatattgttcagccaccgcaactcttccaggactcatcgaaggggaacaccaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16353356 |
gtgcttcgtcctccatacgtcataccatattgttcagccaccgcaactcttccaggactcatcgaaggggaactccaaa |
16353278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University