View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_101 (Length: 315)
Name: NF9361A_low_101
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_101 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 38059479 - 38059565
Alignment:
| Q |
1 |
gaacagagtataccttctt--atgtgttcaagggacacagagaaatccttggagcagataaggtcataatagaataatgcaatatgc |
85 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| | ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38059479 |
gaacagagtataccttctctcatgtgttcaagggacataaagaaatccttgtagcagataaggtcataatagaataatgcaatatgc |
38059565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 235 - 295
Target Start/End: Original strand, 38059773 - 38059830
Alignment:
| Q |
235 |
tttgcttggaatctagatgtcaataataatgctttctatgctgaattgatgggtgttatgc |
295 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
38059773 |
tttgcttgcaatctagatgtcaata---atgctttctatgctgaattggtgggtgttatgc |
38059830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University