View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_107 (Length: 303)
Name: NF9361A_low_107
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_107 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 185 - 288
Target Start/End: Complemental strand, 33051379 - 33051276
Alignment:
| Q |
185 |
tacatattttccaatataatctctcctatttatatgaaatcaacataacttagaagagattaatttcaattttaattaataaagaatatggtgatatata |
284 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33051379 |
tacatattttataatataatctctcctatttatatgaaatcaacataacttagaagagattaatttcaattttaattaataaagaatatggtgatatata |
33051280 |
T |
|
| Q |
285 |
gtta |
288 |
Q |
| |
|
|||| |
|
|
| T |
33051279 |
gtta |
33051276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 73 - 164
Target Start/End: Complemental strand, 33051519 - 33051428
Alignment:
| Q |
73 |
gtaggtctagtaccctttatattctcttctaattgaaattttgctttgttttttcaaaaaatatatatgtgcaaatatattcgacttgcggt |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33051519 |
gtaggtctagtaccctttatattctcttctaattggaattttgctttgttgtttcaaaaaatatatatgtgcaaatatattcgacttgcggt |
33051428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University