View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_113 (Length: 296)
Name: NF9361A_low_113
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_113 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 79 - 289
Target Start/End: Complemental strand, 8187144 - 8186932
Alignment:
| Q |
79 |
gaaccattgctagtgcaatagtagtaatatgggtgtcgtataatcaactctaaaatacaattaaaaaacgtaaggtgat--aacagaacagtaaacattc |
176 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
8187144 |
gaaccattcctagtgcaatagtagtaatatgggtgtcgtataatcaactctaaaatacaattaaaaaacgtaaggtcatgtaacagaacagtaaacattc |
8187045 |
T |
 |
| Q |
177 |
attaaatataggtgtgaagcagatttacacttactgtgtttatacccttaaatcttttatcttttatctgttttacacgaatcttgagttgaggggaaaa |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8187044 |
attaaatataggtgtgaagcagatttacacttactgtgtttatacccttaaatcttttatcttttatctgttttacacgaatcttgagttgagtggaaaa |
8186945 |
T |
 |
| Q |
277 |
gattgttcttttg |
289 |
Q |
| |
|
||||||||||||| |
|
|
| T |
8186944 |
gattgttcttttg |
8186932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University