View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_135 (Length: 274)
Name: NF9361A_low_135
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_135 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 7 - 267
Target Start/End: Complemental strand, 47469539 - 47469279
Alignment:
| Q |
7 |
ttggggtggattacattgatctctattatcagcaccgtattgacaccactgttcccattgaggacactgtaagtaatagaatctattcttaaaatttgtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47469539 |
ttggggtggattacattgatctctattatcagcaccgtattgacaccactgttcccattgaggacactgtaagtaatagaatctattcttaaaatttgtt |
47469440 |
T |
|
| Q |
107 |
aggaagtggtaggtaggtactagtgttttcgatttggtgttttgaatgaatcacagatgggagagcttaagaagttggttgaagagggaaagattaagta |
206 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47469439 |
aggaagtggtaggtaggtactcgtgtttttgatttggtgttttgaatgaatcacagatgggagagcttaagaagttggttgaagagggaaagattaagta |
47469340 |
T |
|
| Q |
207 |
cataggattatctgaggctagtactgatacaatcagaagggcacatgatgtccatctcatt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||| |
|
|
| T |
47469339 |
cataggattatctgaggctagtactgatacaatcagaagggcacatgctgttcatcccatt |
47469279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University