View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_138 (Length: 270)
Name: NF9361A_low_138
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_138 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 100 - 265
Target Start/End: Original strand, 40758309 - 40758474
Alignment:
| Q |
100 |
atctctaagcattgtgatattattgatgttgaaagaactgttatgctgatgttatttataccgaaagaataatgtatacacaaggaatctattttcaata |
199 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40758309 |
atctgtaagcattgtgatattattgatgttgaaagaattgttatgctgatgttatttatactgaaagaataatgtatacacaaggaatctattttcaata |
40758408 |
T |
|
| Q |
200 |
gatttaacattaaaatattacaatggaaaatccagtcaaattttgtgcaagaccgcagtagtaact |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40758409 |
gatttaacattaaaatattacaatggaaaatccagtcaaattttgtgcaagaccgcagtagtaact |
40758474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 18 - 53
Target Start/End: Original strand, 40758227 - 40758262
Alignment:
| Q |
18 |
gacatcagacatgagataaatgatcaaaccactgcc |
53 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40758227 |
gacatcagacatgagatgaatgatcaaaccactgcc |
40758262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University