View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_139 (Length: 270)
Name: NF9361A_low_139
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_139 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 22 - 270
Target Start/End: Complemental strand, 44547176 - 44546933
Alignment:
| Q |
22 |
cccccgacattcacacaatcggtgcatcgctaactgttagatgggatcaagatctgaaccatttggtctcgatccaacggttaccgatgggctgactgga |
121 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44547176 |
cccccgacat-cacacaatcagtgcatcgctaactgttagatgggatcaagatctgaaccatttggtctcgatccaacggttaccgatgggctgactgga |
44547078 |
T |
|
| Q |
122 |
agcaatggcattcgaatagatagtacatacacatcataaaagaaagataaaatgtggactattagnnnnnnnnnnnnttgacaaatataagattgcatat |
221 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
44547077 |
agcaatgacattcga----atagtacatacacatcataaaagaaagataaaatgtggactattagaaaaaagaaaaattgacaaatttaagattgcatat |
44546982 |
T |
|
| Q |
222 |
taccaagctttccacattaattatatcaatcacatcatcaccatcatcg |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546981 |
taccaagctttccacattaattatatcaatcacatcatcaccatcatcg |
44546933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University