View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_141 (Length: 269)
Name: NF9361A_low_141
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_141 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 20 - 257
Target Start/End: Complemental strand, 41404394 - 41404157
Alignment:
| Q |
20 |
cacatatttcatatggtttctgttcaatcgacttagaaggaagtcaaggaacacaattgcttgcgagtagagcacatgccaaaaatgactctaattgact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41404394 |
cacatatttcatatggtttctgttcaatcgacttagaaggaagtcaaggaacacaattgcttgcgagtagagcacatgccaaaaatgactctaattgact |
41404295 |
T |
 |
| Q |
120 |
cgtaatctatcaaacatgtcttatagggtctgattcctactttcatgcacatcatttcattgcagccacacgattgaaggtcttttgactgccaaaacca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
41404294 |
cgtaatctatcaaacatgtcttatagggtctgattcctactttcatacacatcatttcattgcagccacacgattgaaggtcttttgactgcgaatacca |
41404195 |
T |
 |
| Q |
220 |
gaatctactatttatagcttcaacgtaaatgtgatatt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41404194 |
gaatctactatttatagcttcaacgtaaatgtgatatt |
41404157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University