View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_157 (Length: 258)
Name: NF9361A_low_157
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_157 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 41705155 - 41704904
Alignment:
| Q |
1 |
tggtgttgcagccaccaccttggttacccggctcatgtgtcacacaagacatgccggtaagcaatggtatttggttaaatcagtcacttcctttcaacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705155 |
tggtgttgcagccaccaccttggttacccggttcatgtgtcacacaagacatgccggtaagcaatggtatttggttaaatcagtcacttcctttcaacat |
41705056 |
T |
|
| Q |
101 |
aacttcatccaacacagtgttcattttcaactgttcccctcgtctcttggtttctcctcttaactgctcttcctctagtatttgtcaccgttacttggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705055 |
aacttcatccaacacagtgttcattttcaactgttcccctcgtctcttggtttctcctcttaactgctcttcctctagtatttgtcaccgttacttggaa |
41704956 |
T |
|
| Q |
201 |
aattcaggtcatgttgacacaaatcgagcacttgagtgtgcaagtggtcttc |
252 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41704955 |
aattcaggtcaagttgacacaaatcgagcacttgagtgtgcaagtggtcttc |
41704904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 1453346 - 1453265
Alignment:
| Q |
1 |
tggtgttgcagccaccaccttggttacccggctcatgtgtcacacaagacatgccggtaagcaatggtatttggttaaatca |
82 |
Q |
| |
|
||||| ||||||||| |||||||||||| || |||||||||||||||| |||| ||||||||||| ||||| |||||||| |
|
|
| T |
1453346 |
tggtggtgcagccacaaccttggttacctggttcatgtgtcacacaaggcatgttggtaagcaatgatatttacttaaatca |
1453265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 1465038 - 1464957
Alignment:
| Q |
1 |
tggtgttgcagccaccaccttggttacccggctcatgtgtcacacaagacatgccggtaagcaatggtatttggttaaatca |
82 |
Q |
| |
|
||||| ||||||||| |||||||||||| || |||||||||||||||| |||| ||||||||||| ||||| |||||||| |
|
|
| T |
1465038 |
tggtggtgcagccacaaccttggttacctggttcatgtgtcacacaaggcatgttggtaagcaatgatatttacttaaatca |
1464957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University