View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_160 (Length: 257)
Name: NF9361A_low_160
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_160 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 12 - 251
Target Start/End: Complemental strand, 37036036 - 37035797
Alignment:
| Q |
12 |
aaagaaatcatccaagtatagttaaggtaacaaataaatagtaaaaaatattcatgcatctatatactacatgtaatctttgttttttcaccaaaatttc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37036036 |
aaagaaatcatccaagtatagttaaggtaacaaataaatagtaaaaaatattcatgcatctatatagtacatgtaatctttgttttttcaccaaaatttc |
37035937 |
T |
|
| Q |
112 |
tagacatatctaagttcgttcattcctagtcgatgtaggaccaagtactcatgcttgaaatcgaacaaaccaaaaagactaacattacgcgttggcaggt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37035936 |
tagacatatctaagttcgttcattcctagtcgatgtaggaccaagtactcatgcttgaaatcgaacaaaccaaaaagactaacattacgcgttggcaggt |
37035837 |
T |
|
| Q |
212 |
tatattggagaacaatgatagtctttctgatggattgcct |
251 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37035836 |
tatattggagaactatgatagtctttctgatggattgcct |
37035797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University