View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_170 (Length: 250)
Name: NF9361A_low_170
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_170 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 4608379 - 4608505
Alignment:
| Q |
124 |
gagcctctctctgataactttctgtgacatctttttgtcatgtaatacagttcttcacgagctagtgtcagaagnnnnnnnatattcttttttcnnnnnn |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4608379 |
gagcctctctctgataactttctgtgacatctttttgtcatgtaatacagttcttcacgagctagtgtcagaagtttttttatattcttttttcaaaaaa |
4608478 |
T |
|
| Q |
224 |
ngttccatctttatccaaatttttagt |
250 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4608479 |
agttccatctttatccaaatttttagt |
4608505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 11 - 60
Target Start/End: Original strand, 4608266 - 4608315
Alignment:
| Q |
11 |
atgaaggtgttttagattttgaagttttatgcaagtaatattctaatggg |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608266 |
atgaaggtgttttagattttgaagttttatgcaagtaatattctaatggg |
4608315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University