View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_180 (Length: 248)
Name: NF9361A_low_180
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_180 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 19 - 247
Target Start/End: Complemental strand, 9665511 - 9665284
Alignment:
| Q |
19 |
gtaataatggaatttgaatactttaatttcagaacaagcttcactaggaagaaaggtaagaacagagtcacaatttccatgattctgtttttggaatgaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
9665511 |
gtaataatggaatttgaatactttaatttcagaacaagcttcactaggaagaaaggtaagaacagagtcacaatttccatgattctgtttttagattgaa |
9665412 |
T |
 |
| Q |
119 |
attggagtttcagaaaatttactgttgttcaatttttgattatgtcttttaattttatagtatacttttcttttctagtaagaatgaagcagattaagtt |
218 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
9665411 |
attggagtttcagaaaatttac-gttgtttaattttttattatgtctttcaattttatagtatacttttcttttctagtaagaatgtagcagactaagtt |
9665313 |
T |
 |
| Q |
219 |
gttggacttggatgttaacaccaaactcg |
247 |
Q |
| |
|
| |||||||||||||||||| || ||||| |
|
|
| T |
9665312 |
gctggacttggatgttaacagcatactcg |
9665284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University