View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_192 (Length: 246)
Name: NF9361A_low_192
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_192 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 23 - 243
Target Start/End: Complemental strand, 4608845 - 4608625
Alignment:
| Q |
23 |
ctcttctcctttttgatgtcaggtgtcaatgaacctgaattaatgtcactgtggtccttctctttctccttcttcttgtttcctaacaaactcttaaacc |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608845 |
ctcttctcctttttgatgtcaggtgtcaatgaacctgaattgatgtcactgtggtccttctctttctccttcttcttgtttcctaacaaactcttaaacc |
4608746 |
T |
 |
| Q |
123 |
atctactagcttttcccataactacttcttcacaagcaagaatctgaagtgtgagtgaatgagaaaaactatgtcaaatgttgaataaacgcaatacgag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608745 |
atctactagcttttcccataactacttcttcacaagcaagaatctgaagtgtgagtgaatgagaaaaactatgtcaaatgttgaataaacgcaatacgag |
4608646 |
T |
 |
| Q |
223 |
ggaatttggtaaaatttaaaa |
243 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4608645 |
ggaatttggtaaaatttaaaa |
4608625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 102 - 143
Target Start/End: Original strand, 43315591 - 43315632
Alignment:
| Q |
102 |
ttcctaacaaactcttaaaccatctactagcttttcccataa |
143 |
Q |
| |
|
|||| ||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
43315591 |
ttccaaacaaacccttcaaccatctactagcttttcccataa |
43315632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University