View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_217 (Length: 241)
Name: NF9361A_low_217
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_217 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 29 - 192
Target Start/End: Original strand, 9457146 - 9457309
Alignment:
| Q |
29 |
tgtttactttatagatgatcattagattgtaataaaaatcacatatagccattttggaatacggtaataaaaatctcaacactcattttgttaccgatct |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9457146 |
tgtttactttatagatgatcattagattgtaataaaaatcacatatagccgttttggaatacggtaataaaaatctcaacactcattttgttaccgatct |
9457245 |
T |
 |
| Q |
129 |
caagtttgtgttttgtgtaggggagagataaaatgtttataaattacaattaatcttgattttc |
192 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9457246 |
caagtttgtgttttgcgtaggggagagataaaatgtttataaattacaattaatcttgattttc |
9457309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University