View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_222 (Length: 238)
Name: NF9361A_low_222
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_222 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 13 - 238
Target Start/End: Original strand, 40688205 - 40688430
Alignment:
| Q |
13 |
aatattaggttattgactatacttataatatcgatgtggaattacatgcaattttgctcatagtttggttttgatcacttgggatattggagtaacggtt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40688205 |
aatattaggttattgactatacttataatatcgatgttgaattacatgcaattttgctcatagtttggttctgatcacttgggatattggagtaacggtt |
40688304 |
T |
|
| Q |
113 |
ttaaggaagccatttgtgaatctaactgcaagactatctccaatctgatagaatctgagtgtaaggaataatcctatatacattcatccttatgctccca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40688305 |
ttaaggaagccatttgtgaatctaactgcaagactatctccaatctgatagaatctgagtgtaaggaataatcctatatacactcatccttatgctccca |
40688404 |
T |
|
| Q |
213 |
tcattcaatatgttagatcctttatg |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40688405 |
tcattcaatatgttagatcctttatg |
40688430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University