View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_242 (Length: 230)
Name: NF9361A_low_242
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_242 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 29670261 - 29670039
Alignment:
| Q |
1 |
agaaacacctgaatcgttcatttacaattgaggttatttgcttaatgtttacttttaactcagttaattaattc-cttagattagacatatatggtccaa |
99 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29670261 |
agaaacacctgaatctttcatttacaattgaggttatttgcttaatgtttacttttaactaagttaattaatttgcttagattagacatatatggtccaa |
29670162 |
T |
|
| Q |
100 |
attcttnnnnnnnntaaaattgattgtgattgttttatagtggcacccccacctttatcaagttatgttatgttatatcacaaaaaagatgagcatattc |
199 |
Q |
| |
|
|||||| ||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29670161 |
attcttaaaaaa---aaatttgattgtgatcgttttatagtggcacccccacctttatcaagttatgttatgttatatcacaaaaaagatgagcatattc |
29670065 |
T |
|
| Q |
200 |
catcaagtacattgtcatgaatacat |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
29670064 |
catcaagtacattgtcatgaatacat |
29670039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University