View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_271 (Length: 225)
Name: NF9361A_low_271
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_271 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 17 - 205
Target Start/End: Complemental strand, 37908461 - 37908273
Alignment:
| Q |
17 |
tgagatggtggccacctcgtgggatcaaaggattagggatcatttgttgtcgaagaataatttgtttactgaaggtgggaattttgtgagttcgtttcag |
116 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37908461 |
tgagatggtggccacctcgttggatcaaaggattagggatcatttgttgtccaagaataatttgtttactgaaggtgggaattttgtgagttcgtttcag |
37908362 |
T |
|
| Q |
117 |
aggccggttttgtgtgttgttgataggaattttgagctgccggttgcgattcagcatgattttagggataggccgttggttcatgatgt |
205 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37908361 |
aggccggttttgtgtgtttttgataggaattttgagctgccggttgcgattcagcatgattttaggtataggccgttggttcatgatgt |
37908273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University