View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_287 (Length: 219)
Name: NF9361A_low_287
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_287 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 11 - 198
Target Start/End: Complemental strand, 39781146 - 39780960
Alignment:
| Q |
11 |
gttaatttggtgggtttgaattgaaaagttatataaaataacatattcataaattttttgctattagctatagctatttataatattagaggtttaggga |
110 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39781146 |
gttaatttgatgggtttgaattgaaaagttatataaaataacatattcataaaatttttgctattagctatagctatttataatattagaggtttaggga |
39781047 |
T |
|
| Q |
111 |
gttcagacnnnnnnnnnnnnnggaaattcttaagcttgttaagcatatcgtttgtggattttatgtattcagttattcggttgtctgt |
198 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39781046 |
gttcaga-gaaaaaaaaaaaaggaaattcttaagcttgttaagcatatcgtttgtggattttatgtattcagttattcggttgtctgt |
39780960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University