View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_289 (Length: 219)
Name: NF9361A_low_289
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_289 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 6 - 219
Target Start/End: Complemental strand, 48669653 - 48669440
Alignment:
| Q |
6 |
gtagataatactcggatcaaccacgcgttgattgattaatttaattaaatagtaatagatgcatttgcatatttataaagtttttgtgtgcataccttga |
105 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48669653 |
gtagataacacttggatcaaccacgcgttgattgattaatttaattaaatagtaatagatgcatttgcatatttataaagtttttgtgtgcataccttga |
48669554 |
T |
 |
| Q |
106 |
gttcatcatcaggttgatagcatgcaaaatcaatgagataaataggacgtggccttgacatgaagtaaagagcgaaagtgaaaacaaagccagcaagaga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
48669553 |
gttcatcatcaggttgatagcatgcaaaatcaatgagataaataggacgtggccttgacatgaagtaaagagtgaaagtgaaaacaaagacagcaagaga |
48669454 |
T |
 |
| Q |
206 |
agagagaacagatg |
219 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
48669453 |
agagagaacagatg |
48669440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University