View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_291 (Length: 217)
Name: NF9361A_low_291
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_291 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 28 - 217
Target Start/End: Complemental strand, 2528350 - 2528161
Alignment:
| Q |
28 |
tggagttcaagcgtaggtagtaaagtctcatcaaagattgttttaaatttgagtatttttgatcgaatatattaatcacttgagtttaatctcttactat |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2528350 |
tggagttcaagcgtaggtagtaaagtctcatcaaagattgttttaaatttgagtacttttgatcgaatatattaatcacttgagtttaatctcttgctat |
2528251 |
T |
|
| Q |
128 |
aaaacaagatttactttaatatcatacgggtgtctcctttnnnnnnnggaaaatactaatgaatgctcttaaagcattgtttaaagttta |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2528250 |
aaaacaaggtttactttaatatcatacgggtgtctcctttaaaaagaggaaaatactaatgaatgctcttaaagcattgtttaaagttta |
2528161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University