View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9361A_low_300 (Length: 213)

Name: NF9361A_low_300
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9361A_low_300
NF9361A_low_300
[»] chr4 (1 HSPs)
chr4 (149-193)||(28960239-28960283)
[»] chr1 (1 HSPs)
chr1 (21-59)||(29742259-29742297)


Alignment Details
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 149 - 193
Target Start/End: Complemental strand, 28960283 - 28960239
Alignment:
149 gaactaatcccaacaacaactgtaccctgattttgagcaagtacc 193  Q
    |||||||| ||||||||||||||||||||||||||||||||||||    
28960283 gaactaataccaacaacaactgtaccctgattttgagcaagtacc 28960239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 21 - 59
Target Start/End: Complemental strand, 29742297 - 29742259
Alignment:
21 agtagtgattgacctcttcgtatttacaaattatgttcc 59  Q
    |||||||||||||||||||||||||||||||||||||||    
29742297 agtagtgattgacctcttcgtatttacaaattatgttcc 29742259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University