View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_300 (Length: 213)
Name: NF9361A_low_300
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_300 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 149 - 193
Target Start/End: Complemental strand, 28960283 - 28960239
Alignment:
| Q |
149 |
gaactaatcccaacaacaactgtaccctgattttgagcaagtacc |
193 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28960283 |
gaactaataccaacaacaactgtaccctgattttgagcaagtacc |
28960239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 21 - 59
Target Start/End: Complemental strand, 29742297 - 29742259
Alignment:
| Q |
21 |
agtagtgattgacctcttcgtatttacaaattatgttcc |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29742297 |
agtagtgattgacctcttcgtatttacaaattatgttcc |
29742259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University