View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_301 (Length: 212)
Name: NF9361A_low_301
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_301 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 3098856 - 3098921
Alignment:
| Q |
1 |
acggtcacaatccctcttcatgcattgcattcctttcggctacttttgttaccatagagacccaca |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3098856 |
acggtcacaatccctcttcatgcattgcattcctttcggctacttttgttaccatagagacccaca |
3098921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University