View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9361A_low_304 (Length: 211)

Name: NF9361A_low_304
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9361A_low_304
NF9361A_low_304
[»] chr2 (1 HSPs)
chr2 (42-189)||(45626054-45626201)


Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 42 - 189
Target Start/End: Complemental strand, 45626201 - 45626054
Alignment:
42 aacaatattaacatacatgactatactattcgaaagctatatttatattgatttgatttcaggtccaaattcccttgagaaggggaacagtagagggagt 141  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45626201 aacaatattaacatacatgactatactattcgaaagctatatttatattgatttgatttcaggtccaaattcccttgagaaggggaacagtagagggagt 45626102  T
142 tggagtgtcttcaaatttaaaagtgtcgaggagatcagagcaggatgc 189  Q
    || |||||||||||||||||||||||||||||||||||||||||||||    
45626101 tgcagtgtcttcaaatttaaaagtgtcgaggagatcagagcaggatgc 45626054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University