View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9361A_low_31 (Length: 427)

Name: NF9361A_low_31
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9361A_low_31
NF9361A_low_31
[»] chr2 (1 HSPs)
chr2 (146-266)||(11548164-11548284)


Alignment Details
Target: chr2 (Bit Score: 105; Significance: 3e-52; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 146 - 266
Target Start/End: Complemental strand, 11548284 - 11548164
Alignment:
146 agtttggagttgacttcggattatgaaatcttaggattttacgtgggggataaagtagattcgtttggtgattggtatgcaatgaatttgacagattaga 245  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| ||||||    
11548284 agtttgtagttgacttcggattatgaaatcttaggattttacgtgggggataaagtagtttcgtttggtaattggtatgcaatgaatttgacaaattaga 11548185  T
246 ttcaagataaagtttcttagt 266  Q
    |||||||||||||||||||||    
11548184 ttcaagataaagtttcttagt 11548164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University