View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_31 (Length: 427)
Name: NF9361A_low_31
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 3e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 146 - 266
Target Start/End: Complemental strand, 11548284 - 11548164
Alignment:
| Q |
146 |
agtttggagttgacttcggattatgaaatcttaggattttacgtgggggataaagtagattcgtttggtgattggtatgcaatgaatttgacagattaga |
245 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
11548284 |
agtttgtagttgacttcggattatgaaatcttaggattttacgtgggggataaagtagtttcgtttggtaattggtatgcaatgaatttgacaaattaga |
11548185 |
T |
|
| Q |
246 |
ttcaagataaagtttcttagt |
266 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
11548184 |
ttcaagataaagtttcttagt |
11548164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University