View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_315 (Length: 206)
Name: NF9361A_low_315
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_315 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 22 - 161
Target Start/End: Complemental strand, 4027727 - 4027587
Alignment:
| Q |
22 |
gaatttgtgttacgaattgatcctgaaactttaaaattattcaatgaaaccgtatgtaatcat-gatttttaccttttcgttctatatttgtagatattg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||| | ||||||| | || | ||||||||||||||||||| |
|
|
| T |
4027727 |
gaatttgtgttacgaattgatcctgaaactttaagatttttcaatgaaacagtatgtaatcatggttttttacttcttagctctatatttgtagatattg |
4027628 |
T |
|
| Q |
121 |
tatgagatgtgatgtaagaccaaaacctttttgtgaccttc |
161 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
4027627 |
tatgagctgtgaagtaagaccaaaacctttttgtgaccttc |
4027587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 100 - 167
Target Start/End: Complemental strand, 4013366 - 4013299
Alignment:
| Q |
100 |
gttctatatttgtagatattgtatgagatgtgatgtaagaccaaaacctttttgtgaccttctgcctt |
167 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||| ||||||| ||||||| |||| |
|
|
| T |
4013366 |
gttctatatttgtagatattgtatgagctgtagagtaagaccaaaacatttttgttaccttcttcctt |
4013299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 100 - 171
Target Start/End: Original strand, 3951222 - 3951293
Alignment:
| Q |
100 |
gttctatatttgtagatattgtatgagatgtgatgtaagaccaaaacctttttgtgaccttctgccttatat |
171 |
Q |
| |
|
|||||||||||||||||||||| ||| | | | ||||||| ||||| ||||||||||||||| || ||||| |
|
|
| T |
3951222 |
gttctatatttgtagatattgttagagctttaaagtaagacaaaaacttttttgtgaccttcttccatatat |
3951293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University