View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_316 (Length: 206)
Name: NF9361A_low_316
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_316 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 19 - 86
Target Start/End: Complemental strand, 18772184 - 18772117
Alignment:
| Q |
19 |
gtttgtgcagtcagatatatctattgtagtgaggctcttcaacttttccagccaacaatatttgggaa |
86 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
18772184 |
gtttgtgcagtcagatatatctattgtattgaggctcttcaacttttccggccaacaatttttgggaa |
18772117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 87
Target Start/End: Complemental strand, 18770244 - 18770176
Alignment:
| Q |
19 |
gtttgtgcagtcagatatatctattgtagtgaggctcttcaacttttccagccaacaatatttgggaat |
87 |
Q |
| |
|
|||| |||||| |||||||||| ||||| ||||| |||||||||||||||||| ||||| |||| |||| |
|
|
| T |
18770244 |
gtttatgcagttagatatatctgttgtattgagggtcttcaacttttccagcctacaatttttgagaat |
18770176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 21 - 69
Target Start/End: Complemental strand, 11857636 - 11857588
Alignment:
| Q |
21 |
ttgtgcagtcagatatatctattgtagtgaggctcttcaacttttccag |
69 |
Q |
| |
|
||||||||||||||| |||||| |||||||| ||||||||||||||||| |
|
|
| T |
11857636 |
ttgtgcagtcagatacatctatagtagtgagtctcttcaacttttccag |
11857588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 116 - 159
Target Start/End: Complemental strand, 4808658 - 4808615
Alignment:
| Q |
116 |
aaaaaattgtgggttcaaatgctttctatgaccttttactattt |
159 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4808658 |
aaaagattgtgggttcaaatgctttctatgatcttttactattt |
4808615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University