View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_317 (Length: 206)
Name: NF9361A_low_317
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_317 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 4e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 21 - 184
Target Start/End: Complemental strand, 29002342 - 29002179
Alignment:
| Q |
21 |
agctctatcattgaaagtttcagactttttcaactccctttgagcccaagcaacaggatcatcatcaccactaccaaaaccacaaccaccattgttacga |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29002342 |
agctctatcattgaaagtttcagactttttcaactccctttcagcccaagcaacaggatcatcatcaccactaccaaaaccacaaccaccattgttacga |
29002243 |
T |
|
| Q |
121 |
aatggttctgctttcacaatccttgcagtccaagtgtcacttttctttagatatggcttctttg |
184 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29002242 |
aatggttcggctttcacaatccttgcagtccaagtgtcacttttctttagatatggcttctttg |
29002179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 21 - 184
Target Start/End: Complemental strand, 28962613 - 28962456
Alignment:
| Q |
21 |
agctctatcattgaaagtttcagactttttcaactccctttgagcccaagcaacaggatcatcatcaccactaccaaaaccacaaccaccattgttacga |
120 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |||| |||||||||||| |
|
|
| T |
28962613 |
agctctatcattgaatgtttcagactttttcaactccctttgagcccaagcaacaggatcatcatcaccaccacaaa------aaccgccattgttacga |
28962520 |
T |
|
| Q |
121 |
aatggttctgctttcacaatccttgcagtccaagtgtcacttttctttagatatggcttctttg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||| ||||||||||| |
|
|
| T |
28962519 |
aatggttctgctttcacaatccttgcagtccaagtgccacttttcttcagatgtggcttctttg |
28962456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University