View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_331 (Length: 201)
Name: NF9361A_low_331
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_331 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 18 - 180
Target Start/End: Complemental strand, 33736192 - 33736030
Alignment:
| Q |
18 |
aatatgagagtaaggtgaaagacagtacaatgtatactaagcatattaaaatgggtttttctatcatgttagttggatcaattatagttagttcaatatt |
117 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33736192 |
aatatgagagtaaggtgaaagagagtaaaatgtatactaagcatattaaaatgggtttttctatcatgttagttggatcaattatagttagttcaatatt |
33736093 |
T |
|
| Q |
118 |
gtttaaggttgtctagttagttatgaataattgatcatattagttataccatgagttgcgtgc |
180 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
33736092 |
gtttaatgttgtctagttagttatgaacaattgatcatattagttataccataggttgcgtgc |
33736030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University