View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_64 (Length: 357)
Name: NF9361A_low_64
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_64 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 22 - 340
Target Start/End: Complemental strand, 49122813 - 49122495
Alignment:
| Q |
22 |
catgcagttgcagcagctactgtagcagctgcgatagctgttacactaggaggtgaaccaatttgtctagatgggaaacctccttgagagcaagcaggag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49122813 |
catgcagttgcagcagctactgtagcagctgcaatagctgttacactaggaggtgaaccaatttgtctagatgggaaacctccttgagagcaagcaggag |
49122714 |
T |
 |
| Q |
122 |
aatcagctgaagattctacatttgcatacggccaaaatgtagcagcaaaacttgctgcagcatgagctgcagggtgttgcagcaaggtagagacaataag |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49122713 |
aatcagctgaagattctacatttgcatacggccaaaatgtagcagcaaaacttgctgcagcatgagctgcagggtgttgcagcaaggtagagacaataag |
49122614 |
T |
 |
| Q |
222 |
acttgaaaatgtagaagacatgttgagaaaggattggtaatcagcatggttatgtgcaaatggaggacaaggaggaaatgattgatgactagaggatcgt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49122613 |
acttgaaaatgtagaagacatgttgagaaaggattggtaatcagcatggttatgtgcaaatggaggacaaggaggaaatgattgatgactagaggatcgt |
49122514 |
T |
 |
| Q |
322 |
gccatgttattttgatttt |
340 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
49122513 |
gccatgttattttgatttt |
49122495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University