View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_7 (Length: 492)
Name: NF9361A_low_7
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 1e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 1e-82
Query Start/End: Original strand, 160 - 360
Target Start/End: Original strand, 3790141 - 3790340
Alignment:
| Q |
160 |
tctaaagttgaagggagcttcgcaatgccatgctagatgatcaccttcctcgcccttcccctcgtatgtgtctatgagtagtcatactcaacaaattaat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3790141 |
tctaaagttgaagggagcttcgcaatgccatgctagatgatcaccttcctcttccttcccctcttatgtgtctatgagtagtcatactcaacaaattaat |
3790240 |
T |
|
| Q |
260 |
tgaaaacaaattagaataatcataagcgagataagttttaattgagatgatgagtttannnnnnnncttgttgagaaatatgactatttgctcctattcc |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3790241 |
tgaaaacaaattagaataatcataagcgagataagttctaattgagatgatgagttta-ttttttccttgttgagaaatatgactatttgctcctattcc |
3790339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University