View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9361A_low_74 (Length: 346)

Name: NF9361A_low_74
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9361A_low_74
NF9361A_low_74
[»] chr1 (1 HSPs)
chr1 (150-213)||(34683334-34683397)


Alignment Details
Target: chr1 (Bit Score: 64; Significance: 6e-28; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 150 - 213
Target Start/End: Original strand, 34683334 - 34683397
Alignment:
150 gagatgaataatgcagccctagagcttcagaatttattaaaatcttatccaaacacacaaaaaa 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34683334 gagatgaataatgcagccctagagcttcagaatttattaaaatcttatccaaacacacaaaaaa 34683397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University