View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_76 (Length: 344)
Name: NF9361A_low_76
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_76 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 120 - 339
Target Start/End: Complemental strand, 44999350 - 44999135
Alignment:
| Q |
120 |
tagggctcacgaattggagtttatggatcaaattgtcctcagtggattgtggcaatggaggttcccatttctatataacgttctcacatttctttattta |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44999350 |
tagggctcacgaattggagtttatggatcaaattgtcctcagtggattgtggcaatggaggttcccatttctatataacgttctcacattt----attta |
44999255 |
T |
|
| Q |
220 |
tttattttttccttccttctatatatgattgtgttctattataattcataaacttgtttatgttgatgtatgtaggcttgttgcgcccatagcttggttt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44999254 |
tttattttttccttccttctatatatgattgtgttctattataattcataaacttgtttatgttgatgtatgtaggcttgttgcgcccatagcttggttt |
44999155 |
T |
|
| Q |
320 |
gtgtgcctctctatgctact |
339 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
44999154 |
gtgtgcctctctatgatact |
44999135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University