View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361A_low_90 (Length: 329)
Name: NF9361A_low_90
Description: NF9361A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361A_low_90 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 13 - 323
Target Start/End: Original strand, 3863292 - 3863602
Alignment:
| Q |
13 |
aagaagggaagagattaatcagcaaactaacaaagacacagaagaacaatgcaaaaggatgactgaggacaatccacgtagcgctatcatcaatgcaaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3863292 |
aagaagggaagagattaatcagcaaactaacaaagacacagaagaacaatgcaaaaggatgactgaggacaatccacgtagcgctatcatcaatgcaaaa |
3863391 |
T |
 |
| Q |
113 |
ccttctgtggtggaagaagaagaagttattctcttcaggcctcttacaaggtataattcagcgccattgtccccgtctacctcagctgatgaacagatat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3863392 |
ccttctgtggtggaagaagaagaagttattctcttcaggcctcttacaaggtataattcagcgccattgtccccgtctacctcagctgatgaacagatat |
3863491 |
T |
 |
| Q |
213 |
cacaagaagaccgtatagaccaaagcttaccatctgatgattgtttgcgacgtgctacatctcttctcatggcacaaaatccagctcaaactcaaactga |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3863492 |
cacaagaagaccgtatagaccaaagcttaccatctgatgattgtttgcgacgtgctacatctcttctcatggcacaaaatccagctcaaactcaaactga |
3863591 |
T |
 |
| Q |
313 |
tccgtgggaat |
323 |
Q |
| |
|
||||||||||| |
|
|
| T |
3863592 |
tccgtgggaat |
3863602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University