View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361_low_13 (Length: 344)
Name: NF9361_low_13
Description: NF9361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 22 - 216
Target Start/End: Complemental strand, 48096276 - 48096082
Alignment:
| Q |
22 |
aagtagcagaaaaagtaacnnnnnnntaataacttttcaaaatcagggggagtttcatgtgtgaaagctatagctataatttttaattgaatttttctat |
121 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48096276 |
aagtagcagaaaaagtaagaaaaaaataataacttttcaaaatcagggggagtttcatttgtgaaagctatagctataatttttaattgaatttttctat |
48096177 |
T |
|
| Q |
122 |
cccctgttcaatttctttaatttgcacaaatgcatgtcttaacacctattttccacttttcaccgatcaaagttccaactttataagtattacct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48096176 |
cccctgttcaatttctttaatttgcacaaatgcatgtcttaacacctattttccacttttcaccaatcaaagttccaactttataagtattacct |
48096082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 48 - 212
Target Start/End: Original strand, 39883320 - 39883478
Alignment:
| Q |
48 |
taataacttttcaaaatcagggggagtttcatgtgtgaaagctatagctataatttttaattgaatttttctatcccctgttcaatttctttaatttgca |
147 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||| || ||| ||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
39883320 |
taataacttctcaaaatcagggggagcttcatgtgtgaaagctataact------tttgattgaatttttctatcccctgctcaatttcattaatttgca |
39883413 |
T |
|
| Q |
148 |
caaatgcatgtcttaacacctattttccacttttcaccgatcaaagttccaactttataagtatt |
212 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
39883414 |
caaatgcatatcttaacacctattttccacttttcaccaatcaaaattccaactttataagtatt |
39883478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University