View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361_low_26 (Length: 264)
Name: NF9361_low_26
Description: NF9361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 25 - 148
Target Start/End: Complemental strand, 49037933 - 49037810
Alignment:
| Q |
25 |
gttgtagaaaaaagaagggtaggaatcttacaagaaggaaggggatcgcattttgttgaagagaagagaaggaagcttacaacttttttgcgtttgtaga |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
49037933 |
gttgtagaaaaaagaagggtaggaatcttacaagaaggaaggggatcgcattttgttgaagagaagagaaggaagcttacaccttttttgtgtttgtaga |
49037834 |
T |
|
| Q |
125 |
aagtagggaggggaatatgaatat |
148 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
49037833 |
aagtagggaggggaatatgaatat |
49037810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 213 - 252
Target Start/End: Complemental strand, 49037745 - 49037706
Alignment:
| Q |
213 |
tgcgatttttgctcgttggtttgagtggtaatgtgatgtc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49037745 |
tgcgatttttgctcgttggtttgagtggtaatgtgatgtc |
49037706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University