View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9361_low_27 (Length: 264)

Name: NF9361_low_27
Description: NF9361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9361_low_27
NF9361_low_27
[»] chr1 (2 HSPs)
chr1 (25-148)||(49037810-49037933)
chr1 (213-252)||(49037706-49037745)


Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 25 - 148
Target Start/End: Complemental strand, 49037933 - 49037810
Alignment:
25 gttgtagaaaaaagaagggtaggaatcttacaagaaggaaggggatcgcattttgttgaagagaagagaaggaagcttacaacttttttgcgtttgtaga 124  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||    
49037933 gttgtagaaaaaagaagggtaggaatcttacaagaaggaaggggatcgcattttgttgaagagaagagaaggaagcttacaccttttttgtgtttgtaga 49037834  T
125 aagtagggaggggaatatgaatat 148  Q
    ||||||||||||||||||||||||    
49037833 aagtagggaggggaatatgaatat 49037810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 213 - 252
Target Start/End: Complemental strand, 49037745 - 49037706
Alignment:
213 tgcgatttttgctcgttggtttgagtggtaatgtgatgtc 252  Q
    ||||||||||||||||||||||||||||||||||||||||    
49037745 tgcgatttttgctcgttggtttgagtggtaatgtgatgtc 49037706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University