View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361_low_33 (Length: 246)
Name: NF9361_low_33
Description: NF9361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 3 - 231
Target Start/End: Original strand, 3790113 - 3790340
Alignment:
| Q |
3 |
gtactacgatcaacgtttcaacaatatctctaaagttgaagggagcttcgcaatgccatgctagatgatcaccttcctcgcccttcccctcgtatgtgtc |
102 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
3790113 |
gtactacgatccacgtttcaacaatagatctaaagttgaagggagcttcgcaatgccatgctagatgatcaccttcctcttccttcccctcttatgtgtc |
3790212 |
T |
 |
| Q |
103 |
tatgagtagtcatactcaacaaattaattgaaaacaaattagaataatcataagcgagataagttttaattgagatgatgagtttannnnnnnncttgtt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
3790213 |
tatgagtagtcatactcaacaaattaattgaaaacaaattagaataatcataagcgagataagttctaattgagatgatgagttta-ttttttccttgtt |
3790311 |
T |
 |
| Q |
203 |
gagaaatatgactatttgctcctattcct |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3790312 |
gagaaatatgactatttgctcctattcct |
3790340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University