View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361_low_37 (Length: 243)
Name: NF9361_low_37
Description: NF9361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 12 - 203
Target Start/End: Complemental strand, 17432142 - 17431948
Alignment:
| Q |
12 |
agaccaaaattctacacatgaaaagcataaatggcaatagatgtt--ccactttaacactgtgtcaccattcacagctcatgcatttcctttgtgtgata |
109 |
Q |
| |
|
||||||| || |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17432142 |
agaccaacatcctacacatgaaaagtataaatggcaatagatgttgcccactttaacactgtgtcaccattcacagctcatgcatttcctttgtgtgata |
17432043 |
T |
 |
| Q |
110 |
gataggtagcttatttgataaaaaattaatcagtatcagcaaaaaactta-agagccaagtgtggcatcagtgtatgttgattttgcagccaagt |
203 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17432042 |
gataggtagcttatttgataaaatattaatcagtatcagcaaaaaacttatagagccaagtgcggcatcagtgtatgttgattttgcagccaagt |
17431948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University