View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361_low_39 (Length: 242)
Name: NF9361_low_39
Description: NF9361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361_low_39 |
 |  |
|
| [»] chr5 (3 HSPs) |
 |  |
|
| [»] scaffold0759 (1 HSPs) |
 |  |  |
|
| [»] scaffold0376 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 39954598 - 39954815
Alignment:
| Q |
19 |
ttagtacacttggattttatattgataaattggtttcatttgtcttattcaaacatgtattaatgattttcnnnnnnnctgtattcaacccgtgcttcgc |
118 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39954598 |
ttagtacacttagattttatattggtaaattggtttcatttgtcttattcaaacatgtattaatgattttcaaaaaaaatgtattcaacccgtgcttcgc |
39954697 |
T |
 |
| Q |
119 |
acgggtttataactagtttgtgaaaagnnnnnnnnnnnctgttttgatctcctttcatatcgactaaacgtttatttgtatttcatatataatataaatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39954698 |
acgggtttataactagtttgtgaaaaaaaaaat------tgttttgatctcctttcatatcgattaaatgtttatttgtatttcatatataatataaatt |
39954791 |
T |
 |
| Q |
219 |
gactaattttatcggactttactt |
242 |
Q |
| |
|
|| ||||||||||||||||||||| |
|
|
| T |
39954792 |
gaataattttatcggactttactt |
39954815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 88
Target Start/End: Complemental strand, 1685279 - 1685210
Alignment:
| Q |
19 |
ttagtacacttggattttatattgataaattggtttcatttgtcttattcaaacatgtattaatgatttt |
88 |
Q |
| |
|
|||||||||||||||||||| || |||| |||||||||| ||||||||||||| || ||| |||||| |
|
|
| T |
1685279 |
ttagtacacttggattttatcttaggaaatcagtttcatttgacttattcaaacatatagtaaggatttt |
1685210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 136
Target Start/End: Complemental strand, 35539245 - 35539209
Alignment:
| Q |
100 |
tattcaacccgtgcttcgcacgggtttataactagtt |
136 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
35539245 |
tattgaacccgtgcttcgcacgggtttgtaactagtt |
35539209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 73
Target Start/End: Original strand, 44800473 - 44800527
Alignment:
| Q |
19 |
ttagtacacttggattttatattgataaattggtttcatttgtcttattcaaaca |
73 |
Q |
| |
|
|||||||||||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
44800473 |
ttagtacacttggattttatcttagtaaatcggtttcatttgtcttattcaaaca |
44800527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0759 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0759
Description:
Target: scaffold0759; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 100 - 136
Target Start/End: Complemental strand, 3459 - 3423
Alignment:
| Q |
100 |
tattcaacccgtgcttcgcacgggtttataactagtt |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3459 |
tattcaacccgtgcttcgcacgggtttataactagtt |
3423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 100 - 137
Target Start/End: Complemental strand, 48519691 - 48519654
Alignment:
| Q |
100 |
tattcaacccgtgcttcgcacgggtttataactagttt |
137 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48519691 |
tattcaacccgtgcttcgcacgggtttgtaactagttt |
48519654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 87
Target Start/End: Original strand, 41053620 - 41053688
Alignment:
| Q |
19 |
ttagtacacttggattttatattgataaattggtttcatttgtcttattcaaacatgtattaatgattt |
87 |
Q |
| |
|
|||||||||||||||||||| || |||| |||||||||||||||||||| |||| || ||| ||||| |
|
|
| T |
41053620 |
ttagtacacttggattttatcttaggaaatcggtttcatttgtcttattcagacatatagtaaggattt |
41053688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0376 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0376
Description:
Target: scaffold0376; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 100 - 136
Target Start/End: Complemental strand, 10819 - 10783
Alignment:
| Q |
100 |
tattcaacccgtgcttcgcacgggtttataactagtt |
136 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10819 |
tattcaacccgtgcttcgcacgggtttgtaactagtt |
10783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 100 - 135
Target Start/End: Original strand, 3795718 - 3795753
Alignment:
| Q |
100 |
tattcaacccgtgcttcgcacgggtttataactagt |
135 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3795718 |
tattcaacccgtgcttcgcacgggtttgtaactagt |
3795753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 86
Target Start/End: Original strand, 11168726 - 11168793
Alignment:
| Q |
19 |
ttagtacacttggattttatattgataaattggtttcatttgtcttattcaaacatgtattaatgatt |
86 |
Q |
| |
|
|||| ||||||||||||||| || | |||| |||||||||| |||||||||||||||| ||| |||| |
|
|
| T |
11168726 |
ttaggacacttggattttatcttaagaaatcagtttcatttgacttattcaaacatgtagtaaggatt |
11168793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 137
Target Start/End: Original strand, 11207668 - 11207700
Alignment:
| Q |
105 |
aacccgtgcttcgcacgggtttataactagttt |
137 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
11207668 |
aacccgtgcttcgcacgggtttgtaactagttt |
11207700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 100 - 137
Target Start/End: Original strand, 32847203 - 32847240
Alignment:
| Q |
100 |
tattcaacccgtgcttcgcacgggtttataactagttt |
137 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
32847203 |
tattcaacccgtgctttgcacgggtttgtaactagttt |
32847240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 100 - 137
Target Start/End: Complemental strand, 41531805 - 41531768
Alignment:
| Q |
100 |
tattcaacccgtgcttcgcacgggtttataactagttt |
137 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
41531805 |
tattcaacccgtgtttcgcacgggtttgtaactagttt |
41531768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 88
Target Start/End: Complemental strand, 52037620 - 52037551
Alignment:
| Q |
19 |
ttagtacacttggattttatattgataaattggtttcatttgtcttattcaaacatgtattaatgatttt |
88 |
Q |
| |
|
|||||||||||||||||||| || |||| |||||||||| ||||||||||||| || ||| |||||| |
|
|
| T |
52037620 |
ttagtacacttggattttatcttaggaaatcagtttcatttgacttattcaaacatatagtaaggatttt |
52037551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 87
Target Start/End: Original strand, 13624129 - 13624197
Alignment:
| Q |
19 |
ttagtacacttggattttatattgataaattggtttcatttgtcttattcaaacatgtattaatgattt |
87 |
Q |
| |
|
|||||||||||||||||||| || |||| |||||||||| ||||||||||||| || ||| ||||| |
|
|
| T |
13624129 |
ttagtacacttggattttatcttaggaaatcagtttcatttgacttattcaaacatatagtaaggattt |
13624197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 136
Target Start/End: Original strand, 17672393 - 17672429
Alignment:
| Q |
100 |
tattcaacccgtgcttcgcacgggtttataactagtt |
136 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
17672393 |
tattgaacccgtgcttcgcacgggtttgtaactagtt |
17672429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 136
Target Start/End: Original strand, 18815133 - 18815169
Alignment:
| Q |
100 |
tattcaacccgtgcttcgcacgggtttataactagtt |
136 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
18815133 |
tattaaacccgtgcttcgcacgggtttgtaactagtt |
18815169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University