View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361_low_42 (Length: 230)
Name: NF9361_low_42
Description: NF9361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 12 - 216
Target Start/End: Original strand, 35645668 - 35645875
Alignment:
| Q |
12 |
agcagagaagggatcagattgttgatacagaggacattgtcaataattcacttaacctgcctttaccaccaccacctccccctctgcctc---tatggga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35645668 |
agcagagaagggatcagattgttgatacagaggacattgtcaataattcacttaacctgcctttaccaccaccacctccccctctgcctcctctatggga |
35645767 |
T |
 |
| Q |
109 |
tcgacactcacgtcatgacaattggacacagcagaacggcataaacaatcagcgccgaggaactgtgaattcatttgcaggacacaaccgatttccttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35645768 |
tcgacactcacgtcatgacaattggacacagcagaacggcataaacaatcagcgccgaggaactgtgaattcatttgcaggacacaaccgatttccttta |
35645867 |
T |
 |
| Q |
209 |
gctgatgt |
216 |
Q |
| |
|
|||||||| |
|
|
| T |
35645868 |
gctgatgt |
35645875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 12 - 215
Target Start/End: Original strand, 11438957 - 11439160
Alignment:
| Q |
12 |
agcagagaagggatcagattgttgatacagaggacattgtcaataattcacttaacctgcctttaccaccaccacctccccctctgcctctatgggatcg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11438957 |
agcagagaagggatcagattgttgatacggaggacattgtcaataattcacttaacctgcctttaccaccacctcctccccctctgcctctatgggatcg |
11439056 |
T |
 |
| Q |
112 |
acactcacgtcatgacaattggacacagcagaacggcataaacaatcagcgccgaggaactgtgaattcatttgcaggacacaaccgatttcctttagct |
211 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11439057 |
acacacacgtcatgacaattggactcagcagaatggcataaacaatcagcgccgaggaactgtgaattcatttgcaggacacaaccgctttcctttagct |
11439156 |
T |
 |
| Q |
212 |
gatg |
215 |
Q |
| |
|
|||| |
|
|
| T |
11439157 |
gatg |
11439160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University