View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9361_low_47 (Length: 201)
Name: NF9361_low_47
Description: NF9361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9361_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 25 - 134
Target Start/End: Complemental strand, 36726587 - 36726478
Alignment:
| Q |
25 |
ggtcgaatttatggctggaagtagattcaaaattggtgatcaaagccttcaaaaatgtttctttagttccttggaagcttagaaacagatggttaaactg |
124 |
Q |
| |
|
||||||| ||||||||||||| ||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36726587 |
ggtcgaaattatggctggaagcagattcagaattggtgatcaaagccttaaaaaatgtttctttagttccttggaagcttagaaacagatggttaaactg |
36726488 |
T |
|
| Q |
125 |
cgttcaattg |
134 |
Q |
| |
|
|||||||||| |
|
|
| T |
36726487 |
cgttcaattg |
36726478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 144 - 185
Target Start/End: Complemental strand, 25276704 - 25276663
Alignment:
| Q |
144 |
gccttctggccactactcactactgagttggcaacttggaaa |
185 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25276704 |
gccttctggctactactcactactgagttggcaacttggaaa |
25276663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University