View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9363_high_11 (Length: 254)
Name: NF9363_high_11
Description: NF9363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9363_high_11 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 24 - 254
Target Start/End: Complemental strand, 10050861 - 10050631
Alignment:
| Q |
24 |
tggtggtttatcttaattcttaaagaaaaacattaacagggccactaactgttagtaagttgactcgatgtataaagatttaccagacgtagaagaactc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10050861 |
tggtggtttatcttaattcttaaagaaaaacattaacaaggccactgactgttggtaagtttactcgatgtataaagatttaccagacgtagaagaactc |
10050762 |
T |
 |
| Q |
124 |
gccaggtgtttgacatcaaaaatggagccagcagctccatcagctcgtttcttgatatcatgagatcctacaacctcgtaatcccaattcccactttcat |
223 |
Q |
| |
|
| ||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
10050761 |
gacagatgtttgacatcaaaaatggagccagcagccccatcagctcgtttcttgatatcatgagatcctacaacctcgtaatcccagttcccattttcat |
10050662 |
T |
 |
| Q |
224 |
agtcttcacagaggaacagctctatatgcct |
254 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |
|
|
| T |
10050661 |
agtcttcacggaggaacagctctatatgcct |
10050631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University