View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9363_low_29 (Length: 257)
Name: NF9363_low_29
Description: NF9363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9363_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 2 - 239
Target Start/End: Complemental strand, 31852613 - 31852376
Alignment:
| Q |
2 |
tcacataaaattgaacaaccatgtcagtttaaatcagttttacacagacatctaatgaaaattcattattttgccgcatcactcaatttttgtaattgca |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31852613 |
tcacataaaattgaacaaccatgtcagtttaaatcagttttacacagacatctaatgaaaattcattattttgccgcatcactcaatttttgtaattgca |
31852514 |
T |
|
| Q |
102 |
ttttttaaattgatggtatgacttggaaatatgaaaatttctcattgtatgtgggtgtaaaactaatttacggtgacagtatactccttaaactcttatg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31852513 |
ttttttaaattgatggtatgacttggaaatatgaaaatttctcattgtatgtgggtgtaaaactaatttacggtgacagtatactccttaaactcttatg |
31852414 |
T |
|
| Q |
202 |
aaaatattaccaaatctttagcttgtggaatgctgtct |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31852413 |
aaaatattaccaaatctttagcttgtggaatgctgtct |
31852376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University